DNA Binding Site
| Accessions: | 1nwq_D (3D-footprint 20231221) |
| Organisms: | Rattus norvegicus |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | AACTGGATTGCGCAATAGGA |
| Binding TFs: | 1nwq_C (bZIP transcription factor, Basic region leucine zipper) |
| Binding Motifs: | 1nwq_AC TTGCGCAA 1nwq_C TTGC |
| Publications: | Miller M, Shuman J.D, Sebastian T, Dauter Z, Johnson P.F. Structural basis for DNA recognition by the basic region leucine zipper transcription factor CCAAT/enhancer-binding protein alpha. The Journal of biological chemistry 278:15178-84 (2003). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.