DNA Binding Site

Accessions: ovo_130 (DrosophilaTF 1.1)
Organisms: Drosophila melanogaster
Libraries: DrosophilaTF 1.1 1
1 Down T.A, Bergman C.M, Su J, Hubbard T.J. Large-scale discovery of promoter motifs in Drosophila melanogaster. PLoS computational biology 3:e7 (2007). [Pubmed]
Length: 32
Sequence: CACCAGCACCCCCTAATCAGACGTAACGGGCC
Binding TFs: ovo (Zinc finger, C2H2 type, Zinc-finger double domain)
Binding Motifs: ovo wgtAACaGw
Publications: Lee S., Garfinkel M. D. Characterization of Drosophila OVO protein DNA binding specificity using random DNA oligomer selection suggests zinc finger degeneration.. Nucleic Acids Res. 28:826-834 (2000). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.