DNA Binding Site
| Accessions: | dra_3 (DBTBS 1.0) |
| Names: | dra_3 |
| Organisms: | Bacillus subtilis |
| Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
| Length: | 70 |
| Sequence: | attgaacaaaatttcaattaccaatttacatatgttcaaaagtcggttatgctaaaaaat atcttaacaa |
| Binding TFs: | SigA (Sigma-70 factor, region 1.2, Sigma-70 factor, region 1.1, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4) |
| Binding Motifs: | SigA_1 TTGACw SigA_2 TAtAAT |
| Publications: | Saxild H.H, Andersen L.N, Hammer K. Dra-nupC-pdp operon of Bacillus subtilis: nucleotide sequence, induction by deoxyribonucleosides, and transcriptional regulation by the deoR-encoded DeoR repressor protein. Journal of bacteriology 178:424-34 (1996). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.