DNA Binding Site
| Accessions: | nifS_2 (DBTBS 1.0) |
| Names: | nifS_2 |
| Organisms: | Bacillus subtilis |
| Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
| Length: | 108 |
| Sequence: | catatgccatcctcctgttgtttacacctgTCTTGAcacctaTATTTAcacaaggaTAAA ATAaacTCAAGAgttttttatggagaacggatggaggaagaccggatg |
| Binding TFs: | YrxA (3H domain, HTH domain) |
| Binding Motifs: | YrxA CCTGTCTTGACACCTATATTTACACAAGGATAAAATAAACTCAAGAGTTT |
| Publications: | Sun D, Setlow P. Cloning, nucleotide sequence, and regulation of the Bacillus subtilis nadB gene and a nifS-like gene, both of which are essential for NAD biosynthesis. Journal of bacteriology 175:1423-32 (1993). [Pubmed] Rossolillo P, Marinoni I, Galli E, Colosimo A, Albertini A.M. YrxA is the transcriptional regulator that represses de novo NAD biosynthesis in Bacillus subtilis. Journal of bacteriology 187:7155-60 (2005). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.