DNA Binding Site

Accessions: 1an2_B (3D-footprint 20260701)
Organisms: Homo sapiens
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: GTGTAGGTCACGTGACCTACAC
Binding TFs: 1an2_A (Helix-loop-helix DNA-binding domain)
Binding Motifs: 1an2_A CGTg
Publications: Ferre-D'Amare A. E., Prendergast G. C., Ziff E. B., Burley S. K. Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain. Nature 363:38-45 (1993). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.