DNA Binding Site

Accessions: 6w1a_F (3D-footprint 20231221)
Organisms: Streptococcus dysgalactiae
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 28
Sequence: TTTTTTGTTGTGAAAGTGGGAAAAATGG
Type: Heterodimer
Binding TFs: 6w1a_A (Helix-turn-helix, Helix-turn-helix domain)
6w1a_B (Helix-turn-helix, Helix-turn-helix domain)
Binding Motifs: 6w1a_A CcCa
6w1a_AB CcCasywdcACa
Publications: Capodagli GC, Tylor KM, Kaelber JT, Petrou VI, Federle MJ, Neiditch MB. Structure-function studies of Rgg binding to pheromones and target promoters reveal a model of transcription factor interplay. Proc Natl Acad Sci U S A 117:24494-24502 (2020). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.