DNA Binding Site
| Accessions: | 1ic8_F (3D-footprint 20231221) |
| Organisms: | Homo sapiens |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | CTGGTGAATTATTAACCAAG |
| Binding TFs: | 1ic8_B (Homeobox domain, Hepatocyte nuclear factor 1 (HNF-1), N terminus) |
| Binding Motifs: | 1ic8_AB GGTGArTTATtAACCAA 1ic8_B TTaATAnntcGCC |
| Publications: | Chi Y.I, Frantz J.D, Oh B.C, Hansen L, Dhe-Paganon S, Shoelson S.E. Diabetes mutations delineate an atypical POU domain in HNF-1alpha. Molecular cell 10:1129-37 (2002). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.