DNA Binding Site
| Accessions: | 5xxp_E (3D-footprint 20231221) |
| Organisms: | Cupriavidus necator, Cupriavidus necator (Alcaligenes eutrophus) |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 25 |
| Sequence: | CTATATTACGCAAACCGTAACGATG |
| Binding TFs: | 5xxp_A / 5xxp_B (Bacterial regulatory helix-turn-helix protein, lysR family) |
| Binding Motifs: | 5xxp_A CGTAAnnnTG 5xxp_AB TtACgnnnnncGTAAnnnT |
| Publications: | Koentjoro MP, Adachi N, Senda M, Ogawa N, Senda T. Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region. FEBS J 285:977-989 (2018). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.