DNA Binding Site

Accessions: 6y42_F (3D-footprint 20241219)
Organisms: strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745, Streptomyces venezuelae
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 36
Sequence: CATTTGACTCGGACACAGACTATCCGAGTATTATCT
Binding TFs: 6y42_B (Transcriptional regulator, Winged helix-turn-helix transcription repressor, HrcA DNA-binding)
Binding Motifs: 6y42_AB ACTcGGATAnnnnnTGTCCGAG
6y42_B CTCGGACA
Publications: Crack JC, Amara P, Volbeda A, Mouesca JM, Rohac R, Pellicer Martinez MT, Huang CY, Gigarel O, Rinaldi C, Le Brun NE, Fontecilla-Camps JC. Electron and Proton Transfers Modulate DNA Binding by the Transcription Regulator RsrR. J Am Chem Soc 142:5104-5116 (2020). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.