DNA Binding Site
Accessions: | 2vy2_W (3D-footprint 20241219) |
Organisms: | Arabidopsis thaliana |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 20 |
Sequence: | ATTTAATCCAATGGTTACAA |
Binding TFs: | 2vy2_A (Floricaula / Leafy protein) |
Binding Motifs: | 2vy2_A tGGtnnnnA |
Publications: | Hamès C, Ptchelkine D, Grimm C, Thevenon E, Moyroud E, Gérard F, Martiel J.L, Benlloch R, Parcy F, Müller C.W. Structural basis for LEAFY floral switch function and similarity with helix-turn-helix proteins. The EMBO journal 27:2628-37 (2008). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.