DNA Binding Site
Accessions: | 6edt_P (3D-footprint 20231221), 6vw0_P (3D-footprint 20231221) |
Organisms: | Mycobacterium tuberculosis, strain ATCC 25618 / H37Rv |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 65 |
Sequence: | CGCCCGCTTCGGGGCAACCCTGCCAGTCTAATACAAATCCGGCAATGGAGTCAAGACCAG GTTCG |
Type: | Heterodimer |
Binding TFs: | 6edt_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4) 6vw0_M (CarD-like/TRCF domain) |
Binding Motifs: | 6edt_F GCCAGtCTAAnnnAnnnnnnnnnnnnnaGTCAAG 6vw0_CDFJM CTTGACtnnnnnnnnnnnnnTnTnTTAGACTGGCnngGT |
Publications: | Boyaci H, Chen J, Jansen R, Darst SA, Campbell EA. Structures of an RNA polymerase promoter melting intermediate elucidate DNA unwinding. Nature 565:382-385 (2019). [Pubmed] Lilic M, Chen J, Boyaci H, Braffman N, Hubin EA, Herrmann J, Müller R, Mooney R, Landick R, Darst SA, Campbell EA. The antibiotic sorangicin A inhibits promoter DNA unwinding in a Mycobacterium tuberculosis rifampicin-resistant RNA polymerase. Proc Natl Acad Sci U S A 117:30423-30432 (2020). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.