DNA Binding Site

Accessions: 4lll_E (3D-footprint 20250804), 4lll_F (3D-footprint 20250804), 4lll_G (3D-footprint 20250804), 4lll_H (3D-footprint 20250804), 4lll_K (3D-footprint 20250804), 4lll_L (3D-footprint 20250804), 4lln_E (3D-footprint 20250804), 4lln_F (3D-footprint 20250804), 4lln_G (3D-footprint 20250804), 4lln_H (3D-footprint 20250804), 4lln_K (3D-footprint 20250804), 4lln_L (3D-footprint 20250804)
Organisms: Staphylococcus aureus
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 24
Sequence: ATTTAGTTAGATATCTAACTAAAT
Type: Heterodimer
Binding TFs: 4lll_B / 4lll_J / 4lln_B (MarR family, MarR family, Winged helix-turn-helix DNA-binding, Winged helix DNA-binding domain)
4lll_D (MarR family, MarR family, Winged helix-turn-helix DNA-binding, Winged helix DNA-binding domain)
4lln_D (MarR family, MarR family, Winged helix-turn-helix DNA-binding, Winged helix DNA-binding domain)
4lln_I (MarR family, MarR family, Winged helix-turn-helix DNA-binding, Winged helix DNA-binding domain)
4lln_J (MarR family, MarR family, Winged helix-turn-helix DNA-binding, Winged helix DNA-binding domain)
Binding Motifs: 4lll_AB TTnnnTAgAnnTCTAAnnA
4lll_CD TnntTAnnnnTCTAannAA
4lll_IJ TTnnTTAGAnntCTAA
4lll_J cTAa
4lln_AB TTnnTTAgAnnTcTAAnnAAA
4lln_CD TTAGAnnTsTAAnnA
4lln_I TCTAAnnAA
4lln_IJ TTnnTTAGAnnTCTAAnnAA
Publications: Birukou I, Seo S.M, Schindler B.D, Kaatz G.W, Brennan R.G. Structural mechanism of transcription regulation of the Staphylococcus aureus multidrug efflux operon mepRA by the MarR family repressor MepR. Nucleic acids research 42:2774-88 (2014). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.