DNA Binding Site

Accessions: 1hdd_B (3D-footprint 20260701), 3hdd_D (3D-footprint 20260701)
Organisms: Drosophila melanogaster
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: TTAGGTAATTACATGGCAAA
Type: Heterodimer
Binding TFs: 1hdd_D (Homeobox domain)
3hdd_B (Homeobox domain)
Binding Motifs: 1hdd_CD TAnnnTnaTTAC
3hdd_AB GTAATAACnTTA
Publications: Kissinger C. R., Liu B., Martin-Blanco E., Kornberg T. B., Pabo C. O. Crystal structure of an engrailed homeodomain-DNA complex at 2.8 A resolution: a framework for understanding homeodomain-DNA interactions. Cell 63:579-590 (1990). [Pubmed]

Fraenkel E, Rould M.A, Chambers K.A, Pabo C.O. Engrailed homeodomain-DNA complex at 2.2 A resolution: a detailed view of the interface and comparison with other engrailed structures. Journal of molecular biology 284:351-61 (1998). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.