DNA Binding Site
| Accessions: | pyrR_1 (DBTBS 1.0) |
| Names: | pyrR_1 |
| Organisms: | Bacillus subtilis |
| Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
| Length: | 66 |
| Sequence: | ggagaatatgtcgaatttgaagcgccgcttcccgaggatatggcagaattaatcgaaaac ctcaga |
| Binding TFs: | PurR (Phosphoribosyl transferase domain, Bacterial purine repressor, N-terminal) |
| Binding Motifs: | PurR AAWwmCGAAyrwTa |
| Publications: | Shin B.S, Stein A, Zalkin H. Interaction of Bacillus subtilis purine repressor with DNA. Journal of bacteriology 179:7394-402 (1997). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.