DNA Binding Site

Accessions: 3q5f_C (3D-footprint 20250804)
Organisms: Salmonella enterica subsp. enterica serovar Typhimurium, strain LT2 / SGSC1412 / ATCC 700720
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: ATAACTTAGCAAGCTAATTATA
Type: Heterodimer
Binding TFs: 3q5f_A (MarR family, MarR family, Winged helix DNA-binding domain)
3q5f_B (MarR family, MarR family, Winged helix DNA-binding domain)
Binding Motifs: 3q5f_A AGCTAAnnRT
3q5f_AB TAnntTAGCAAGCTAAnnAT
Publications: Dolan K.T, Duguid E.M, He C. Crystal structures of SlyA protein, a master virulence regulator of Salmonella, in free and DNA-bound states. The Journal of biological chemistry 286:22178-85 (2011). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.