DNA Binding Site
| Accessions: | 2zhg_B (3D-footprint 20260701) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | GCCTCAAGTTAACTTGAGGC |
| Binding TFs: | 2zhg_A (MerR family regulatory protein, MerR, DNA binding, MerR HTH family regulatory protein) |
| Binding Motifs: | 2zhg_A aCtt |
| Publications: | Watanabe S, Kita A, Kobayashi K, Miki K. Crystal structure of the [2Fe-2S] oxidative-stress sensor SoxR bound to DNA. Proceedings of the National Academy of Sciences of the United States of America 105:4121-6 (2008). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.