DNA Binding Site
| Accessions: | 1hjb_G (3D-footprint 20231221), 1hjb_I (3D-footprint 20231221), 1io4_E (3D-footprint 20231221) |
| Organisms: | Homo sapiens, Mus musculus |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 25 |
| Sequence: | AAGATTTCCAAACTCTGTGGTTGCG |
| Type: | Heterodimer |
| Binding TFs: | 1hjb_A (bZIP transcription factor, Basic region leucine zipper) 1hjb_C / 1hjb_F / 1io4_C (Runt domain) 1io4_B (bZIP transcription factor, Basic region leucine zipper) |
| Binding Motifs: | 1io4_B tcnaAa 1hjb_A gGaAA 1hjb_ABC TTTCCAAAnnnTGTGGTTG 1hjb_DEF AACCACAnnnTTTGGAAA 1io4_ABC TTTCCAAAnnnTGTGGT |
| Publications: | Tahirov T.H, Inoue-Bungo T, Morii H, Fujikawa A, Sasaki M, Kimura K, Shiina M, Sato K, Kumasaka T, Yamamoto M, Ishii S, Ogata K. Structural analyses of DNA recognition by the AML1/Runx-1 Runt domain and its allosteric control by CBFbeta. Cell 104:755-67 (2001). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.