DNA Binding Site

Accessions: 1lb2_K (3D-footprint 20250804), 3n4m_D (3D-footprint 20250804)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: CTTTTTTCCTAAAATGTGAT
Type: Heterodimer
Binding TFs: 1lb2_A (Cyclic nucleotide-binding domain, Bacterial regulatory proteins, crp family, Crp-like helix-turn-helix domain)
3n4m_A (Cyclic nucleotide-binding domain, Bacterial regulatory proteins, crp family, Crp-like helix-turn-helix domain)
Binding Motifs: 1lb2_ABE TwnnnnnnnnnntGtGA
3n4m_ABC TwnnnnnnnnnnTGtGA
Publications: Benoff B., Yang H., Lawson CL., Parkinson G., Liu J., Blatter E., Ebright YW., Berman HM., Ebright RH. Structural basis of transcription activation: the CAP-alpha CTD-DNA complex. Science. 297(5586):1562-6 (2002). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.