DNA Binding Site

Accessions: MA1268.2.13 (JASPAR 2024)
Organisms: Arabidopsis thaliana
Libraries: JASPAR 2024 1
1 Rauluseviciute I, Riudavets-Puig R, Blanc-Mathieu R, Castro-Mondragon JA, Ferenc K, Kumar V, Lemma RB, Lucas J, Cheneby J, Baranasic D, Khan A, Fornes O, Gundersen S, Johansen M, Hovig E, Lenhard B, Sandelin A, Wasserman WW, Parcy F, Mathelier A. JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res : (2023). [Pubmed]
Length: 21
Sequence: AAGAGCGAAAGGAAAATGTGA
Type: Heterodimer
Binding TFs: Q9SEZ3 (Dof domain, zinc finger)
Q9SEZ3
Binding Motifs: MA1268.2 ttyaCTTTTtyyTTTtttttt
Publications: Yanagisawa S. Dof1 and Dof2 transcription factors are associated with expression of multiple genes involved in carbon metabolism in maize. Plant J. 21:281-288 (2000). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.