DNA Binding Site

Accessions: 4fth_C (3D-footprint 20241219)
Organisms: Aquifex aeolicus, strain VF5
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: TTGCAAATTTGCAAATGCAT
Type: Heterodimer
Binding TFs: 4fth_A (Bacterial regulatory protein, Fis family)
4fth_B (Bacterial regulatory protein, Fis family)
Binding Motifs: 4fth_A TGCAAA
4fth_AB TTGCAnnnnTGCAAA
Publications: Vidangos N.K, Heideker J, Lyubimov A, Lamers M, Huo Y, Pelton J.G, Ton J, Gralla J, Berger J, Wemmer D.E. DNA recognition by a σ(54) transcriptional activator from Aquifex aeolicus. Journal of molecular biology 426:3553-68 (2014). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.