DNA Binding Site
| Accessions: | 4i2o_X (3D-footprint 20231221) |
| Organisms: | Bradyrhizobium japonicum |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 24 |
| Sequence: | CTATCTTGATTTCAATCAATTCCC |
| Binding TFs: | 4i2o_B (Cyclic nucleotide-binding domain, Bacterial regulatory proteins, crp family, Crp-like helix-turn-helix domain) |
| Binding Motifs: | 4i2o_B TCAa 4i2o_AB tGAnnnnnnTCa |
| Publications: | Bonnet M, Kurz M, Mesa S, Briand C, Hennecke H, Grütter M.G. The structure of Bradyrhizobium japonicum transcription factor FixK2 unveils sites of DNA binding and oxidation. The Journal of biological chemistry 288:14238-46 (2013). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.