DNA Binding Site
| Accessions: | 5d4r_T (3D-footprint 20231221) |
| Organisms: | Bacillus subtilis, strain 168 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | ATAATTAGTACGTACAAATA |
| Type: | Heterodimer |
| Binding TFs: | 5d4r_A (Bacterial regulatory proteins, gntR family, DeoR-like helix-turn-helix domain, HTH domain) 5d4r_B (Bacterial regulatory proteins, gntR family, DeoR-like helix-turn-helix domain, HTH domain) |
| Binding Motifs: | 5d4r_A ctnnCA 5d4r_AB TGtnCGTaCCa |
| Publications: | Jain D, Narayanan N, Nair DT. Plasticity in Repressor-DNA Interactions Neutralizes Loss of Symmetry in Bipartite Operators. J Biol Chem 291:1235-42 (2016). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.