DNA Binding Site
| Accessions: | dppA_2 (DBTBS 1.0) |
| Names: | dppA_2 |
| Organisms: | Bacillus subtilis |
| Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
| Length: | 38 |
| Sequence: | atttgttagaatattcataatttagtaaaaaaggagga |
| Binding TFs: | CodY (CodY GAF-like domain, CodY helix-turn-helix domain, HTH domain) |
| Binding Motifs: | CodY AAAAAksckGA |
| Publications: | Serror P, Sonenshein A.L. Interaction of CodY, a novel Bacillus subtilis DNA-binding protein, with the dpp promoter region. Molecular microbiology 20:843-52 (1996). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.