DNA Binding Site

Accessions: 1k78_C (3D-footprint 20231221), 1k78_G (3D-footprint 20231221)
Organisms: Homo sapiens, Mus musculus
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 25
Sequence: GTGCCGGAGATGGGCTCCAGTGGCC
Type: Heterodimer
Binding TFs: 1k78_A ('Paired box' domain)
1k78_F (Ets-domain)
1k78_I ('Paired box' domain)
Binding Motifs: 1k78_BI tGGnnnnnnnntCCG
1k78_A CCAnTnnanCnTnTCT
1k78_EF CGGAGAnnnGnnnnanngG
Publications: Garvie C. W., Hagman J., Wolberger C. Structural studies of Ets-1/Pax5 complex formation on DNA.. Mol. Cell 8:1267-1276 (2001). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.