DNA Binding Site
Accessions: | 1k78_C (3D-footprint 20241219), 1k78_G (3D-footprint 20241219) |
Organisms: | Homo sapiens, Mus musculus |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 25 |
Sequence: | GTGCCGGAGATGGGCTCCAGTGGCC |
Type: | Heterodimer |
Binding TFs: | 1k78_A ('Paired box' domain) 1k78_F (Ets-domain) 1k78_I ('Paired box' domain) |
Binding Motifs: | 1k78_BI tGGnnnnnnnntCCG 1k78_A CCAnTnnanCnTnTCT 1k78_EF CGGAGAnnnGnnnnanngG |
Publications: | Garvie C. W., Hagman J., Wolberger C. Structural studies of Ets-1/Pax5 complex formation on DNA.. Mol. Cell 8:1267-1276 (2001). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.