DNA Binding Site
Accessions: | 1dh3_B (3D-footprint 20241219), 1dh3_D (3D-footprint 20241219), 5zk1_B (3D-footprint 20241219), 5zko_B (3D-footprint 20241219), 5zko_D (3D-footprint 20241219) |
Organisms: | Mus musculus, Homo sapiens |
Libraries: | 3D-footprint 20241219 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 20 |
Sequence: | CTTGGCTGACGTCAGCCAAG |
Type: | Heterodimer |
Binding TFs: | 1dh3_C (bZIP transcription factor, Basic region leucine zipper) 5zk1_A (bZIP transcription factor, Basic region leucine zipper) 5zko_C (bZIP transcription factor, Basic region leucine zipper) |
Binding Motifs: | 1dh3_AC TgnCgTCA 1dh3_C CGnCA 5zk1_AC CGtCnnc 5zko_ACGH GCTGACGTCAGC |
Publications: | Schumacher M.A, Goodman R.H, Brennan R.G. The structure of a CREB bZIP.somatostatin CRE complex reveals the basis for selective dimerization and divalent cation-enhanced DNA binding. The Journal of biological chemistry 275:35242-7 (2000). [Pubmed] Song Y, Zhai L, Valencia Swain J, Chen Y, Wang P, Chen L, Liu Y, Xiang S. Structural Insights into the CRTC2-CREB Complex Assembly on CRE. J Mol Biol 430:1926-1939 (2018). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.