DNA Binding Site
| Accessions: | 5tw1_O (3D-footprint 20231221), 6m7j_O (3D-footprint 20231221), 6vvs_O (3D-footprint 20231221), 6vvt_O (3D-footprint 20231221), 6vvv_O (3D-footprint 20231221) |
| Organisms: | Mycobacterium smegmatis, Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155), Mycobacterium tuberculosis, strain ATCC 25618 / H37Rv |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 26 |
| Sequence: | GCTTGACAAAAGTGTTAAATTGTGCT |
| Type: | Heterodimer |
| Binding TFs: | 6m7j_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4) 5tw1_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4) 6vvs_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4) 6vvt_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4) 6vvv_F (Sigma-70 factor, region 1.2, Sigma-70 region 3, Sigma-70 region 2 , Sigma-70, region 4) |
| Binding Motifs: | 5tw1_F CTTGACAnnnnnnnnnnnnTnTGCT 6m7j_F AGCanAnnnnnnnnnnnntGTCAAG 6vvs_F CTTGACAnnnnnnnnnnnnTnTGCT 6vvs_FT AGCAnAnnnnnnnncnnnTGTCaAG 6vvt_F AGCAnAnnnnnnnnnnnnTGTCAAG 6vvv_F CTTGACAnnnnnnnnnnnnTnTGCT 6vvv_FT AGCAnAnnnnnnnnnnnnTGTCAAG |
| Publications: | Hubin EA, Fay A, Xu C, Bean JM, Saecker RM, Glickman MS, Darst SA, Campbell EA. Structure and function of the mycobacterial transcription initiation complex with the essential regulator RbpA. Elife : (2017). [Pubmed] Boyaci H, Chen J, Jansen R, Darst SA, Campbell EA. Structures of an RNA polymerase promoter melting intermediate elucidate DNA unwinding. Nature 565:382-385 (2019). [Pubmed] Lilic M, Chen J, Boyaci H, Braffman N, Hubin EA, Herrmann J, Müller R, Mooney R, Landick R, Darst SA, Campbell EA. The antibiotic sorangicin A inhibits promoter DNA unwinding in a Mycobacterium tuberculosis rifampicin-resistant RNA polymerase. Proc Natl Acad Sci U S A 117:30423-30432 (2020). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.