DNA Binding Site

Accessions: 1h88_D (3D-footprint 20231221), 1h89_D (3D-footprint 20231221), 1h8a_D (3D-footprint 20231221)
Organisms: Homo sapiens
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 25
Sequence: ATGTGGCGCAATCCTTAACGGACTG
Type: Heterodimer
Binding TFs: 1h8a_B (bZIP transcription factor, Basic region leucine zipper)
1h88_B (bZIP transcription factor, Basic region leucine zipper)
1h89_A / 1h89_B (bZIP transcription factor, Basic region leucine zipper)
Binding Motifs: 1h89_ABC TGGCGCAAnnnntAACGGa
1h88_ABC GTGGCGcAAnnnnTAACGGA
1h88_B rTGGC
1h89_A TTGCg
1h8a_ABC TCCGTTAnnnGTTGCGCCAC
Publications: Tahirov T.H, Sato K, Ichikawa-Iwata E, Sasaki M, Inoue-Bungo T, Shiina M, Kimura K, Takata S, Fujikawa A, Morii H, Kumasaka T, Yamamoto M, Ishii S, Ogata K. Mechanism of c-Myb-C/EBP beta cooperation from separated sites on a promoter. Cell 108:57-70 (2002). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.