DNA Binding Site
| Accessions: | 6p0t_C (3D-footprint 20231221), 6p0u_C (3D-footprint 20231221) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 27 |
| Sequence: | AATGTTGTGTTTTTAACAGACTACATT |
| Type: | Heterodimer |
| Binding TFs: | 6p0t_B (Bacterial regulatory protein, Fis family) 6p0u_B (Bacterial regulatory protein, Fis family) |
| Binding Motifs: | 6p0t_ABE TGTnTTnnnnACAGACTAnA 6p0t_B TgTntT 6p0u_ABEF AnnnnTGTGTTnnnnACMGCC |
| Publications: | Hancock SP, Cascio D, Johnson RC. Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res 47:8874-8887 (2019). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.