DNA Binding Site
| Accessions: | 4rb1_D (3D-footprint 20231221) |
| Organisms: | Magnetospirillum gryphiswaldense, strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 24 |
| Sequence: | CGCGATAATGATAATCATTATCCG |
| Binding TFs: | 4rb1_B (Ferric uptake regulator family) |
| Binding Motifs: | 4rb1_AB CGATnnnnnTnnTnnnnnT 4rb1_B cGAt |
| Publications: | Deng Z, Wang Q, Liu Z, Zhang M, Machado AC, Chiu TP, Feng C, Zhang Q, Yu L, Qi L, Zheng J, Wang X, Huo X, Qi X, Li X, Wu W, Rohs R, Li Y, Chen Z. Mechanistic insights into metal ion activation and operator recognition by the ferric uptake regulator. Nat Commun : (2015). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.