DNA Binding Site
| Accessions: | 4auw_C (3D-footprint 20231221), 4auw_H (3D-footprint 20231221) |
| Organisms: | Mus musculus |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 20 |
| Sequence: | AATTGCTGACGTCAGCATTA |
| Type: | Heterodimer |
| Binding TFs: | 4auw_B (bZIP transcription factor, bZIP Maf transcription factor) 4auw_E (bZIP transcription factor, bZIP Maf transcription factor) 4auw_F (bZIP transcription factor, bZIP Maf transcription factor) |
| Binding Motifs: | 4auw_AB TGCtnACGTnarCA 4auw_E TGCtnnCg 4auw_EF TGCnAACGnTTGCA |
| Publications: | Textor LC, Wilmanns M, Holton SJ. Expression, purification, crystallization and preliminary crystallographic analysis of the mouse transcription factor MafB in complex with its DNA-recognition motif Cmare. Acta Crystallogr Sect F Struct Biol Cryst Commun : (2007). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.