DNA Binding Site

Accessions: Eip74EF_6 (DrosophilaTF 1.1)
Organisms: Drosophila melanogaster
Libraries: DrosophilaTF 1.1 1
1 Down T.A, Bergman C.M, Su J, Hubbard T.J. Large-scale discovery of promoter motifs in Drosophila melanogaster. PLoS computational biology 3:e7 (2007). [Pubmed]
Length: 20
Sequence: GGGATTGCGGAAATTACCGG
Binding TFs: Eip74EF (Ets-domain)
Binding Motifs: Eip74EF mgAAyCMGGAArTgrks
Publications: Urness L. D., Thummel C. S. Molecular interactions within the ecdysone regulatory hierarchy: DNA binding properties of the Drosophila ecdysone-inducible E74A protein. Cell 63:47-61 (1990). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.