DNA Binding Site
Accessions: | 1lb2_J (3D-footprint 20231221), 3n4m_E (3D-footprint 20231221) |
Organisms: | Escherichia coli, strain K12 |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 20 |
Sequence: | ATCACATTTTAGGAAAAAAG |
Type: | Heterodimer |
Binding TFs: | 1lb2_A (Cyclic nucleotide-binding domain, Bacterial regulatory proteins, crp family, Crp-like helix-turn-helix domain) 3n4m_A (Cyclic nucleotide-binding domain, Bacterial regulatory proteins, crp family, Crp-like helix-turn-helix domain) |
Binding Motifs: | 1lb2_ABE TwnnnnnnnnnntGtGA 3n4m_ABC TwnnnnnnnnnnTGtGA |
Publications: | Benoff B., Yang H., Lawson CL., Parkinson G., Liu J., Blatter E., Ebright YW., Berman HM., Ebright RH. Structural basis of transcription activation: the CAP-alpha CTD-DNA complex. Science. 297(5586):1562-6 (2002). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.