DNA Binding Site

Accessions: 1u8r_E (3D-footprint 20260701), 1u8r_K (3D-footprint 20260701), 2isz_E (3D-footprint 20260701), 2it0_E (3D-footprint 20260701)
Organisms: Mycobacterium tuberculosis, strain ATCC 25618 / H37Rv
Libraries: 3D-footprint 20260701 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 32
Sequence: CCCTGTTAGCACAGGCTGCCCTAATTTTAGTG
Type: Heterodimer
Binding TFs: 1u8r_B / 1u8r_D (Iron dependent repressor, N-terminal DNA binding domain, Iron dependent repressor, metal binding and dimerisation domain, FeoA domain, Winged helix DNA-binding domain)
1u8r_J (Iron dependent repressor, N-terminal DNA binding domain, Iron dependent repressor, metal binding and dimerisation domain, FeoA domain, Winged helix DNA-binding domain)
2isz_B / 2isz_D (Iron dependent repressor, N-terminal DNA binding domain, Iron dependent repressor, metal binding and dimerisation domain, Winged helix DNA-binding domain)
2it0_B (Iron dependent repressor, N-terminal DNA binding domain, Iron dependent repressor, metal binding and dimerisation domain, Winged helix DNA-binding domain)
2it0_D (Iron dependent repressor, N-terminal DNA binding domain, Iron dependent repressor, metal binding and dimerisation domain, Winged helix DNA-binding domain)
Binding Motifs: 1u8r_ABCD AGCAcAGGCTgCCCTAA
1u8r_B CCcTaA
1u8r_GHIJ TTAGCACAGGCTGCCCT
2isz_ABCD AGnanAGGCTnCCCt
2isz_B TTAGGG
2it0_ABCD AGGGnAGCCTnnGCT
2it0_B TTAGGG
Publications: Wisedchaisri G, Holmes R.K, Hol W.G. Crystal structure of an IdeR-DNA complex reveals a conformational change in activated IdeR for base-specific interactions. Journal of molecular biology 342:1155-69 (2004). [Pubmed]

Wisedchaisri G, Chou C.J, Wu M, Roach C, Rice A.E, Holmes R.K, Beeson C, Hol W.G. Crystal structures, metal activation, and DNA-binding properties of two-domain IdeR from Mycobacterium tuberculosis. Biochemistry 46:436-47 (2007). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.