DNA Binding Site
Accessions: | ctaA_2 (DBTBS 1.0) |
Names: | ctaA_2, ctaA-Ps;A3 |
Organisms: | Bacillus subtilis |
Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
Length: | 45 |
Sequence: | gcagcagtatgttaagaaggtgaatattgtatgaataaagcatta |
Binding TFs: | ResD (Response regulator receiver domain, Transcriptional regulatory protein, C terminal) |
Binding Motifs: | ResD AATyTTGTGAm |
Publications: | Zhang X, Hulett F.M. ResD signal transduction regulator of aerobic respiration in Bacillus subtilis: ctaA promoter regulation. Molecular microbiology 37:1208-19 (2000). [Pubmed] Sun G, Sharkova E, Chesnut R, Birkey S, Duggan M.F, Sorokin A, Pujic P, Ehrlich S.D, Hulett F.M. Regulators of aerobic and anaerobic respiration in Bacillus subtilis. Journal of bacteriology 178:1374-85 (1996). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.