DNA Binding Site
| Accessions: | 6jgw_C (3D-footprint 20260701) |
| Organisms: | Pseudomonas putida |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 27 |
| Sequence: | TTGACCCTATAGTGGCTACAGGGTGTT |
| Binding TFs: | 6jgw_B (MerR family regulatory protein, MerR, DNA binding, MerR HTH family regulatory protein) |
| Binding Motifs: | 6jgw_AB CnnTnTnGTnGCTnnAnnG 6jgw_B CnnTnTnGT |
| Publications: | Liu X, Hu Q, Yang J, Huang S, Wei T, Chen W, He Y, Wang D, Liu Z, Wang K, Gan J, Chen H. Selective cadmium regulation mediated by a cooperative binding mechanism in CadR. Proc Natl Acad Sci U S A 116:20398-20403 (2019). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.