DNA Binding Site
| Accessions: | 5und_E (3D-footprint 20260701) |
| Organisms: | Homo sapiens |
| Libraries: | 3D-footprint 20260701 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 24 |
| Sequence: | CGCCCCCTGCTGGCCTCTGTGGGC |
| Type: | Heterodimer |
| Binding TFs: | 5und_A (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger, C2H2-type zinc-finger domain) 5und_B (Zinc finger, C2H2 type, Zinc-finger double domain, C2H2-type zinc finger, C2H2-type zinc-finger domain) |
| Binding Motifs: | 5und_A cGCCCCCTGCTGg 5und_AB CCAGCAGGGGGCGcGcCCCCTGCTG |
| Publications: | Hashimoto H, Wang D, Horton JR, Zhang X, Corces VG, Cheng X. Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA. Mol Cell 66:711-720 (2017). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.