DNA Binding Site

						

			
Accessions: 6mrj_M (3D-footprint 20231221)

			
Organisms: Helicobacter pylori, Helicobacter pylori (strain ATCC 700392 / 26695)
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 35
Sequence: CAGATATAACACTAATTCATTTTAAATAATAATTA
Binding TFs: 6mrj_D (Ribbon-helix-helix protein, copG family, NikR C terminal nickel binding domain)
Binding Motifs: 6mrj_ABCD TTAnTACtnnnnnnnnnnnAGTGtTAy
6mrj_D TTAnTAT
			
	
			


			

				

				
				
				
				

			

			

		

	
Disclaimer and license


These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.