DNA Binding Site

Accessions: 1l3l_E (3D-footprint 20241219), 1l3l_F (3D-footprint 20241219), 1l3l_G (3D-footprint 20241219), 1l3l_H (3D-footprint 20241219)
Organisms: Agrobacterium tumefaciens, Rhizobium radiobacter (Agrobacterium tumefaciens)
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 20
Sequence: GATGTGCAGATCTGCACATC
Type: Heterodimer
Binding TFs: 1l3l_A (Bacterial regulatory proteins, luxR family, Autoinducer binding domain)
1l3l_C / 1l3l_D (Bacterial regulatory proteins, luxR family, Autoinducer binding domain)
Binding Motifs: 1l3l_A tkTGCA
1l3l_AC TtTGCAnnnnnGCA
1l3l_BD GTGCAnnnnTGCA
Publications: Zhang R.G, Pappas K.M, Pappas T, Brace J.L, Miller P.C, Oulmassov T, Molyneaux J.M, Anderson J.C, Bashkin J.K, Winans S.C, Joachimiak A. Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA. Nature 417:971-4 (2002). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.