DNA Binding Site
Accessions: | 1l3l_E (3D-footprint 20231221), 1l3l_F (3D-footprint 20231221), 1l3l_G (3D-footprint 20231221), 1l3l_H (3D-footprint 20231221) |
Organisms: | Agrobacterium tumefaciens, Rhizobium radiobacter (Agrobacterium tumefaciens) |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 20 |
Sequence: | GATGTGCAGATCTGCACATC |
Type: | Heterodimer |
Binding TFs: | 1l3l_A (Bacterial regulatory proteins, luxR family, Autoinducer binding domain) 1l3l_C / 1l3l_D (Bacterial regulatory proteins, luxR family, Autoinducer binding domain) |
Binding Motifs: | 1l3l_A tkTGCA 1l3l_AC TtTGCAnnnnnGCA 1l3l_BD GTGCAnnnnTGCA |
Publications: | Zhang R.G, Pappas K.M, Pappas T, Brace J.L, Miller P.C, Oulmassov T, Molyneaux J.M, Anderson J.C, Bashkin J.K, Winans S.C, Joachimiak A. Structure of a bacterial quorum-sensing transcription factor complexed with pheromone and DNA. Nature 417:971-4 (2002). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.