DNA Binding Site
| Accessions: | pbpE_2 (DBTBS 1.0) |
| Names: | pbpE_2 |
| Organisms: | Bacillus subtilis |
| Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
| Length: | 26 |
| Sequence: | ggatttttcaaaatatttgaaacgtt |
| Binding TFs: | AbrB (Antidote-toxin recognition MazE) |
| Binding Motifs: | AbrB vkkTkmCAWwAA |
| Publications: | Strauch M.A. Delineation of AbrB-binding sites on the Bacillus subtilis spo0H, kinB, ftsAZ, and pbpE promoters and use of a derived homology to identify a previously unsuspected binding site in the bsuB1 methylase promote. Journal of bacteriology 177:6999-7002 (1995). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.