DNA Binding Site
Accessions: | Rel_8 (DrosophilaTF 1.1) |
Organisms: | Drosophila melanogaster |
Libraries: | DrosophilaTF 1.1 1 1 Down T.A, Bergman C.M, Su J, Hubbard T.J. Large-scale discovery of promoter motifs in Drosophila melanogaster. PLoS computational biology 3:e7 (2007). [Pubmed] |
Length: | 20 |
Sequence: | GACACGGGGAGTCCCCTATG |
Binding TFs: | Rel (Ankyrin repeat, Rel homology domain (RHD), Ankyrin repeats (3 copies), Ankyrin repeat, Ankyrin repeats (many copies)) |
Binding Motifs: | Rel GGGGAwtCmCc |
Publications: | Senger K, Armstrong G.W, Rowell W.J, Kwan J.M, Markstein M, Levine M. Immunity regulatory DNAs share common organizational features in Drosophila. Molecular cell 13:19-32 (2004). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.