DNA Binding Site

Accessions: 3jre_D (3D-footprint 20231221)
Organisms: Escherichia coli, strain K12
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 27
Sequence: AAATTTGCTCATTTTTCAAACAAATTT
Binding TFs: 3jre_B (Bacterial regulatory protein, Fis family)
Binding Motifs: 3jre_AB TGTntGnnnnnTgnGCA
3jre_B CanACA
Publications: Stella S, Cascio D, Johnson R.C. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis. Genes & development 24:814-26 (2010). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.