DNA Binding Site
| Accessions: | 2hzv_J (3D-footprint 20231221), 2hzv_L (3D-footprint 20231221) |
| Organisms: | Escherichia coli, strain K12 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 30 |
| Sequence: | AGTATGACGATTTTAAGTATTCGTCATACT |
| Binding TFs: | 2hzv_A / 2hzv_D / 2hzv_H (Ribbon-helix-helix protein, copG family, NikR C terminal nickel binding domain) |
| Binding Motifs: | 2hzv_A TCAta 2hzv_ABCD GTyTGAnnnnnnnnnnnnnnnnTCAwAC 2hzv_EFGH aGTATGAcnnnnnnnnnnnnnnnTCATAC |
| Publications: | Schreiter E.R, Wang S.C, Zamble D.B, Drennan C.L. NikR-operator complex structure and the mechanism of repressor activation by metal ions. Proceedings of the National Academy of Sciences of the United States of America 103:13676-81 (2006). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.