DNA Binding Site

Accessions: 5iyd_X (3D-footprint 20231221)
Organisms: Homo sapiens
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 80
Sequence: GAAGGGCGCCTATAAAAGGGGGTGGGGGCGTTTTTTTTTTTTTTTTTTTTCGAACACTCG
AGCCGAGCAGACGTGCCTAC
Type: Heterodimer
Binding TFs: 5iyd_P (Transcription factor TFIID (or TATA-binding protein, TBP))
5iyd_M (Cyclin, N-terminal domain, Transcription factor TFIIB repeat, TFIIB zinc-binding)
Binding Motifs: 5iyd_M TTTTnttnTTTnntT
5iyd_P TTTTATA
Publications: He Y, Yan C, Fang J, Inouye C, Tjian R, Ivanov I, Nogales E. Near-atomic resolution visualization of human transcription promoter opening. Nature 533:359-65 (2016). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.