DNA Binding Site

Accessions: 5hlh_P (3D-footprint 20250804)
Organisms: Staphylococcus epidermidis, strain ATCC 35984 / RP62A
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 24
Sequence: TAACTCAATCGCGCGCGATTGAGT
Binding TFs: 5hlh_E (MarR family, HxlR-like helix-turn-helix, Sugar-specific transcriptional regulator TrmB, Transcriptional regulator PadR-like family, FeoC like transcriptional regulator, MarR family, Winged helix DNA-binding domain)
Binding Motifs: 5hlh_E gCGATtnAG
Publications: Liu G, Liu X, Xu H, Liu X, Zhou H, Huang Z, Gan J, Chen H, Lan L, Yang CG. Structural Insights into the Redox-Sensing Mechanism of MarR-Type Regulator AbfR. J Am Chem Soc 139:1598-1608 (2017). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.