DNA Binding Site
| Accessions: | 4p9u_H (3D-footprint 20231221) |
| Organisms: | strain ATCC 39315 / El Tor Inaba N16961, Vibrio cholerae serotype O1 |
| Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
| Length: | 31 |
| Sequence: | TTTTATGTTCTGGTTTGACCAGTTGCCTAAG |
| Binding TFs: | 4p9u_F (Bacterial regulatory proteins, gntR family, FadR C-terminal domain) |
| Binding Motifs: | 4p9u_F TnaCCa |
| Publications: | Shi W, Kovacikova G, Lin W, Taylor R.K, Skorupski K, Kull F.J. The 40-residue insertion in Vibrio cholerae FadR facilitates binding of an additional fatty acyl-CoA ligand. Nature communications 6:6032 (2015). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.