DNA Binding Site
| Accessions: | aprE_8 (DBTBS 1.0) |
| Names: | aprE_8 |
| Organisms: | Bacillus subtilis |
| Libraries: | DBTBS 1.0 1 1 Sierro N, Makita Y, de Hoon M, Nakai K. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic acids research 36:D93-6 (2008). [Pubmed] |
| Length: | 46 |
| Sequence: | attgttctcacggaagcacacgcaggtcatttgaacgaattttttc |
| Binding TFs: | SinR (Helix-turn-helix, Anti-repressor SinI, Helix-turn-helix domain, Cro/C1-type HTH DNA-binding domain, Helix-turn-helix domain) |
| Binding Motifs: | SinR GTTCTyT |
| Publications: | Ogura M, Shimane K, Asai K, Ogasawara N, Tanaka T. Binding of response regulator DegU to the aprE promoter is inhibited by RapG, which is counteracted by extracellular PhrG in Bacillus subtilis. Molecular microbiology 49:1685-97 (2003). [Pubmed] Gaur N.K, Oppenheim J, Smith I. The Bacillus subtilis sin gene, a regulator of alternate developmental processes, codes for a DNA-binding protein. Journal of bacteriology 173:678-86 (1991). [Pubmed] Olmos J, de Anda R, Ferrari E, BolÃvar F, Valle F. Effects of the sinR and degU32 (Hy) mutations on the regulation of the aprE gene in Bacillus subtilis. Molecular & general genetics : MGG 253:562-7 (1997). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.