DNA Binding Site

Accessions: 3zpl_C (3D-footprint 20241219), 3zpl_D (3D-footprint 20241219), 3zpl_G (3D-footprint 20241219), 3zpl_H (3D-footprint 20241219)
Organisms: 2) / M145, Streptomyces coelicolor (strain ATCC BAA-471 / A3
Libraries: 3D-footprint 20241219 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 22
Sequence: AAAGATTGAGATCTCAATCTTT
Type: Heterodimer
Binding TFs: 3zpl_B (MarR family, MarR family, Winged helix DNA-binding domain)
3zpl_F (MarR family, MarR family, Winged helix DNA-binding domain)
Binding Motifs: 3zpl_AB AAnGTTGAnnnnTCAAnCT
3zpl_B AAGATTGA
3zpl_EF AAnnTTGAnnnnTCAAnnTT
Publications: Stevenson C.E, Assaad A, Chandra G, Le T.B, Greive S.J, Bibb M.J, Lawson D.M. Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography. Nucleic acids research 41:7009-22 (2013). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.