DNA Binding Site

						

			
Accessions: 6cim_G (3D-footprint 20231221)

			
Organisms: Homo sapiens
Libraries: 3D-footprint 20231221 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 51
Sequence: GGTTTTGTCTGGCTTCACACTTGATTTGCATCACTGTGTAAGACAGGCCAG
Binding TFs: 6cim_N (HMG (high mobility group) box, Domain of unknown function (DUF1898))
Binding Motifs: 6cim_DN AAgt
			
Publications: Kim MS, Chuenchor W, Chen X, Cui Y, Zhang X, Zhou ZH, Gellert M, Yang W. Cracking the DNA Code for V(D)J Recombination. Mol Cell 70:358-370 (2018). [Pubmed]

	
			


			

				

				
				
				
				

			

			

		

	
Disclaimer and license


These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.