DNA Binding Site

Accessions: 5ed4_D (3D-footprint 20250804), 5ed4_H (3D-footprint 20250804)
Organisms: Mycobacterium tuberculosis, strain ATCC 25618 / H37Rv
Libraries: 3D-footprint 20250804 1
1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed]
Length: 25
Sequence: TAGATGCTGTGAATCAGCTGTGAAT
Type: Heterodimer
Binding TFs: 5ed4_A (Response regulator receiver domain, Transcriptional regulatory protein, C terminal)
5ed4_B (Response regulator receiver domain, Transcriptional regulatory protein, C terminal)
5ed4_F (Response regulator receiver domain, Transcriptional regulatory protein, C terminal)
Binding Motifs: 5ed4_A AGCTGTGA
5ed4_AB ynCAGcwnnnTCnCAG
5ed4_EF tCnCAGnnnnnTCaCAG
Publications: He X, Wang L, Wang S. Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis. Sci Rep : (2016). [Pubmed]

Disclaimer and license

These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.