DNA Binding Site
Accessions: | 1z9c_L (3D-footprint 20231221) |
Organisms: | Bacillus subtilis, strain 168 |
Libraries: | 3D-footprint 20231221 1 1 Contreras-Moreira B. 3D-footprint: a database for the structural analysis of protein-DNA complexes. Nucleic acids research 38:D91-7 (2010). [Pubmed] |
Length: | 27 |
Sequence: | ACAATTAAATTGTATACAATTAAATTG |
Binding TFs: | 1z9c_F (MarR family, MarR family, Winged helix DNA-binding domain) |
Binding Motifs: | 1z9c_EF TTnAAnCnAnTTnRnTnnAA |
Publications: | Hong M, Fuangthong M, Helmann J.D, Brennan R.G. Structure of an OhrR-ohrA operator complex reveals the DNA binding mechanism of the MarR family. Molecular cell 20:131-41 (2005). [Pubmed] |
Disclaimer and license
These data are available AS IS and at your own risk. The EEAD/CSIC do not give any representation or warranty nor assume any liability or responsibility for the data nor the results posted (whether as to their accuracy, completeness, quality or otherwise). Access to these data is available free of charge for ordinary use in the course of research. Downloaded data have CC-BY-NC-SA license. FootprintDB is also available at RSAT::Plants, part of the INB/ELIXIR-ES resources portfolio.